RKO Colorectal Adenocarcinoma SIRT1 Knock Out Cell Line (RKO SIRT1 KO)

RKO Colorectal Adenocarcinoma SIRT1 Knock Out Cell Line (RKO SIRT1 KO)

Human colorectal adenocarcinoma cell line, RKO with a complete deletion of the Sirtuin 1 (SIRT1) gene.

SIRT1 is the most conserved mammalian NAD+-dependent protein deacetylase and an important cellular metabolic and stress sensor. Through deacetylation of transcription factors and co-factors critically involved in metabolic homeostasis, inflammatory responses, and stress resistance, SIRT1 directly couples cellular metabolic status (via NAD+) to transcriptional reprogramming in response to environmental changes.

From the laboratory of Xiaoling Li, PhD, National Institute of Environmental Health Sciences/NIH.

Catalog Number Product DataSheet Size AVAILABILITY Price Qty
ENH132-FP
RKO Colorectal Adenocarcinoma SIRT1 Knock Out Cell Line (RKO SIRT1 KO)
1 vial 4-6 weeks
Regular Price:$580.00
On Sale:

This product is for sale to Nonprofit customers only. For profit customers, please Contact Us for more information.

Specifications

Product Type: Cell Line
Name: RKO SIRT1 KO
Cell Type: Human colorectal adenocarcinoma cell
Accession ID: Q96EB6
Organism: Homo sapiens, human
Source: Colon
Morphology: Epithelial
Biosafety Level: BSL 1
Subculturing: Adherent, 1:3 to 1:8 dilution
Growth Conditions: DMEM + 10% FBS
Cryopreservation: Complete growth medium supplemented with 10% DMSO
Storage: LN2
Shipped: Dry Ice

Research
Human colorectal adenocarcinoma cell line, RKO, was transiently transfected with a Cas9WT mammalian expression vector expressing a gRNA targeting exon 5 (GGACAATTCCAGCCATCTCTCT) of human SIRT1 gene (Horizon Discovery, Cambridge, UK). Cell clones with complete deletion (KO) of human SIRT1 gene were identified by immunofluorescent staining, immunoblotting analysis and confirmed by genomic DNA PCR and sequencing. Cells were then cultured in DMEM medium with 10% FBS.
Data
Provider
From the laboratory of Xiaoling Li, PhD, National Institute of Environmental Health Sciences/NIH.
References
  1. Boyd D, Florent G, Kim P, Brattain M. Determination of the levels of urokinase and its receptor in human colon carcinoma cell lines. Cancer Res. 1988 Jun 1;48(11):3112-6. PubMed PMID: 2835152.
  2. Smith ML, Chen IT, Zhan Q, O'Connor PM, Fornace AJ Jr. Involvement of the p53 tumor suppressor in repair of u.v.-type DNA damage. Oncogene. 1995 Mar 16;10(6):1053-9. PubMed PMID: 7700629.
  3. Brattain MG, Levine AE, Chakrabarty S, Yeoman LC, Willson JK, Long B. Heterogeneity of human colon carcinoma. Cancer Metastasis Rev. 1984;3(3):177-91. Review. PubMed PMID: 6437669.
  4. Bhat MK, Yu Cl, Yap N, Zhan Q, Hayashi Y, Seth P, Cheng S. Tumor suppressor p53 is a negative regulator in thyroid hormone receptor signaling pathways. J Biol Chem. 1997 Nov 14;272(46):28989-93. PubMed PMID: 9360971.
  5. Smith ML, Chen IT, Zhan Q, O'Connor PM, Fornace AJ Jr. Involvement of the p53 tumor suppressor in repair of u.v.-type DNA damage. Oncogene. 1995 Mar 16;10(6):1053-9. PubMed PMID: 7700629.

If you publish research with this product, please let us know so we can cite your paper.