HEK293T SIRT1 Knock Out Cell Line (HEK293T SIRT1 KO)

HEK293T SIRT1 Knock Out Cell Line (HEK293T SIRT1 KO)

Human embryonic kidney 293 (HEK293) cells with a complete deletion of the Sirtuin 1 (SIRT1) gene.

SIRT1 is the most conserved mammalian NAD+-dependent protein deacetylase and an important cellular metabolic and stress sensor. Through deacetylation of transcription factors and co-factors critically involved in metabolic homeostasis, inflammatory responses, and stress resistance, SIRT1 directly couples cellular metabolic status (via NAD+) to transcriptional reprogramming in response to environmental changes.

From the laboratory of Xiaoling Li, PhD, National Institute of Environmental Health Sciences/NIH.

Catalog Number Product DataSheet Size AVAILABILITY Price Qty
ENH131-FP
HEK293T SIRT1 Knock Out Cell Line (HEK293T SIRT1 KO)
1 vial In stock
Regular Price:$580.00
On Sale:

This product is for sale to Nonprofit customers only. For profit customers, please Contact Us for more information.

Specifications

Product Type: Cell Line
Name: HEK293T SIRT1 KO
Cell Type: Human embryonic kidney cells
Accession ID: Q96EB6
Morphology: Epithelial
Source: Embryonic kidney
Organism: Homo sapiens, human
Biosafety Level: BSL 2
Growth Conditions: DMEM + 10% FBS
Subculturing: Adherent, 1:3 to 1:12 dilution
Cryopreservation: Complete growth medium supplemented with 10% DMSO
Storage: LN2
Shipped: Dry Ice

Research
HEK293T is a highly transfectable derivative of human embryonic kidney 293 cells, and contains the SV40 T-antigen. SIRT1 KO HEK293T cells were generated by using a Cas9WT mammalian expression vector expressing a gRNA targeting exon 5 (GGACAATTCCAGCCATCTCTCT) of human SIRT1 gene (Horizon Discovery, Cambridge, UK). Cell clones with deletion both copies (SIRT1-/-, KO) of human SIRT1 gene were identified by immunofluorescent staining, immunoblotting analysis and confirmed by genomic DNA PCR and sequencing.
Data
Provider
From the laboratory of Xiaoling Li, PhD, National Institute of Environmental Health Sciences/NIH.